tRNA Anti-codon Sequence

Doldol · **Posted:** Tue Mar 06, 2018 9:18 pm

Needy wrote:

Doldol wrote:

winter wrote:

mRNA sequence:
UAC AGU UCG GAU GUA CCU CUA UCA A

tRNA sequence:
AUG UCA AGC CUA CAU GGA GAU AGU U (i think this is correct)

Well I got this generated by Bio Python (Python Bioinformatics library) which should be correct if the mRNA sequence is aka the complement. And the tRNA is aka thymidine to uracil replacement.
(Both starting from the base sequence.)

1. UACAGUUCGGAUGUACCUCUAUCAAUU
2. AUGUCAAGCCUACAUGGAGAUAGUUAA

Which is the same as winter but I guess with padding at the end to conform to some formatting standard?
Imagine doing this manually without a program lolololol

Now use the tRNA Anti-codon chart to basically determine the corresponding letter in the message :s

First Base
Second Base
Third Base

Doldol wrote:

Also asking for homework/science help on these forums tends to be a mistake. :3

I actually already knew the answer but shhh

You have to tell me what you want :3

Do you perhaps want the protein sequence? (Using NCBI table id 1)

>> MSSLHGDS* (* = stop symbol)

Is this helping you out or just a fun quiz? Otherwise nvm as this stuff has some of the worst documentation I've seen in a while. (Don't need that game xD)

Spoiler: Show

Smiles · **Posted:** Tue Mar 06, 2018 9:24 pm

here is the correct : msniubvffbjfnkwpkmlbutrexgqplffbwhbdfmamjnfhv

hope it helps :)

winter · **Posted:** Tue Mar 06, 2018 11:58 pm

Fuckyou

Needy · **Posted:** Wed Mar 07, 2018 12:00 am

Smiles wrote:

here is the correct : msniubvffbjfnkwpkmlbutrexgqplffbwhbdfmamjnfhv

hope it helps :)

Thanks Smiley, what would I do w/o you

winter wrote:

Fuckyou

ding ding

:^)

Needy · **Posted:** Wed Mar 07, 2018 12:29 am

SpazzO wrote:

Using Standard translation code
The translator takes a DNA or RNA sequence consisting of A, T or U, C, and G.
Ambiguous nucleotides (e.g. M, V, X) are not recognized.
Whitespace and numbers are ignored.
The start amino acid appears in red.
The stop codon is translated as "*" (default) unless otherwise specified and appears blue.

Spoiler: Show

Actually, this is basically right too. Just took the mRNA triplet codon of three nucleotide's to any possible tRNA anti-codon in Eukaryotas for the 20 standard amino acids involved in translation. Basically a reverse codon of tRNA which is kinda neat.

amino acid -> tRNA anticodon -> mRNA codon

Then you can convert each DNA sequence through individual genetic codes like ciliate, dasycladacean and hexamita nuclear code, whatever fuck that is. What coding can do for you, man.

Central · **Posted:** Wed Mar 07, 2018 4:06 am

English please >:)

SpazzO · **Posted:** Wed Mar 07, 2018 11:51 am

Needy wrote:

SpazzO wrote:

Using Standard translation code
The translator takes a DNA or RNA sequence consisting of A, T or U, C, and G.
Ambiguous nucleotides (e.g. M, V, X) are not recognized.
Whitespace and numbers are ignored.
The start amino acid appears in red.
The stop codon is translated as "*" (default) unless otherwise specified and appears blue.

Spoiler: Show

Actually, this is basically right too. Just took the mRNA triplet codon of three nucleotide's to any possible tRNA anti-codon in Eukaryotas for the 20 standard amino acids involved in translation. Basically a reverse codon of tRNA which is kinda neat.

amino acid -> tRNA anticodon -> mRNA codon

Then you can convert each DNA sequence through individual genetic codes like ciliate, dasycladacean and hexamita nuclear code, whatever fuck that is. What coding can do for you, man.

No way... I was kinda right? Super stoked :D

Dutchie · **Posted:** Wed Mar 07, 2018 11:56 am

Like i feel pretty dumb right now.

Yiggles Moto · **Posted:** Wed Mar 07, 2018 12:17 pm

7‌‌

Needy · **Posted:** Wed Mar 07, 2018 12:28 pm

Yiggles Moto wrote:

7‌‌

Yes

Register

Login

tRNA Anti-codon Sequence

Print view

Previous topic | Next topic

Who is online