Register
Login 




New Topic Post Reply  [ 21 posts ]  Go to page
 Previous << 
1, 2, 3
 >> Next 
  Print view
Previous topic | Next topic 
Author Message
Offline 
PostPosted: Tue Mar 06, 2018 9:18 pm 
User avatar
Community Leader
Legend
Steam ID: STEAM_0:1:84775876
Joined: Fri Jul 29, 2011 4:52 pm
Posts: 6450
Location: l: 179° 56′ 39.4″, b: +0° 2′ 46.2″, d: 7,940 ± 420 parsecs, from Via Lactea galactic center.
Needy wrote:
Doldol wrote:
winter wrote:
mRNA sequence:
UAC AGU UCG GAU GUA CCU CUA UCA A

tRNA sequence:
AUG UCA AGC CUA CAU GGA GAU AGU U (i think this is correct)



Well I got this generated by Bio Python (Python Bioinformatics library) which should be correct if the mRNA sequence is aka the complement. And the tRNA is aka thymidine to uracil replacement.
(Both starting from the base sequence.)

1. UACAGUUCGGAUGUACCUCUAUCAAUU
2. AUGUCAAGCCUACAUGGAGAUAGUUAA

Which is the same as winter but I guess with padding at the end to conform to some formatting standard?
Imagine doing this manually without a program lolololol

Now use the tRNA Anti-codon chart to basically determine the corresponding letter in the message :s

First Base
Second Base
Third Base

Doldol wrote:
Also asking for homework/science help on these forums tends to be a mistake. :3

I actually already knew the answer but shhh


You have to tell me what you want :3

Do you perhaps want the protein sequence? (Using NCBI table id 1)

>> MSSLHGDS* (* = stop symbol)

Is this helping you out or just a fun quiz? Otherwise nvm as this stuff has some of the worst documentation I've seen in a while. (Don't need that game xD)

Spoiler: Show

Spoiler: Show
Been there, done that. No regrets, never give up on what's important. Prioritize. Happiness is all that matters.
I really like meowers but can't own any for the time being. Image

Software Developer with a fondness for Python & UE4.
🐱‍👤
Image

ImageImageImage
Interested in Star Citizen? - Use STAR-PZ6J-4C62 and get us both some cool extras :3


Top
 Profile  
 Social 
Offline 
PostPosted: Tue Mar 06, 2018 9:24 pm 
User avatar
EgN Member
Veteran
Steam ID: STEAM_0:0:4949658
Joined: Wed Jul 19, 2017 6:24 am
Posts: 361
Location: Michigan
here is the correct : msniubvffbjfnkwpkmlbutrexgqplffbwhbdfmamjnfhv

hope it helps :)
Needy/Wanty is the best person alive tbh

Life goals:
[ ] get a dog
[ ] get a house
[ ] marry Needy/Wanty
[ ] live with Needy/Wanty, with dog, in house.

Image


Top
 Profile  
  
Offline 
PostPosted: Tue Mar 06, 2018 11:58 pm 
User avatar
EgN Member
Elder
Steam ID: STEAM_0:1:195157239
Joined: Sun Dec 11, 2016 10:53 pm
Posts: 766
Fuckyou
"Time always flows equal and doesn’t undergo any changes, independent of existence or absence of things, independent of their motion or rest."
Image

Image

Image

Image


Top
 Profile  
  
Offline 
PostPosted: Wed Mar 07, 2018 12:00 am 
User avatar
Community Member
Legend
Steam ID: STEAM_0:0:150625838
Joined: Mon Oct 12, 2015 2:42 am
Posts: 4024
Location: NorCal
Smiles wrote:
here is the correct : msniubvffbjfnkwpkmlbutrexgqplffbwhbdfmamjnfhv

hope it helps :)

Thanks Smiley, what would I do w/o you

winter wrote:
Fuckyou

ding ding

:^)
To all the the ladies, peace, and humptiness.

Image

ask me about film, novels, fashion, cinematography, and/or music & you'll have my ear for hours

Doldol 🐾: I'm a Hyper Nova
Doldol 🐾: Kharn can be a
Doldol 🐾: Super Massive Black Hole
EgN-S| Needy: lmao
Doldol 🐾: xD
EgN-S| Needy: dude idk why, but i thought you were going to say super massive black cocc
Doldol 🐾: You can be a
Doldol 🐾: LOL
Doldol 🐾: nono thatd then be micro astroid
Doldol 🐾: or so ive heard
EgN-S| Needy: Like he's just one big degenerate penus
Doldol 🐾: ROFL
Doldol 🐾: IK
Doldol 🐾: xd

her favourite colour was yellow

Smiley: yes, I have a job now so I can be the breadwinner of the household and you can just relax to Rex all day :)

Image

life goals
[  ] become legend before mootinie
[  ] get 10,000 post before mutiny
[  ] marry smiley

Tricky: i don't think any of the staff+ are here to slap their e-penis on you


Top
 Profile  
  
Offline 
PostPosted: Wed Mar 07, 2018 12:29 am 
User avatar
Community Member
Legend
Steam ID: STEAM_0:0:150625838
Joined: Mon Oct 12, 2015 2:42 am
Posts: 4024
Location: NorCal
SpazzO wrote:
Using Standard translation code
The translator takes a DNA or RNA sequence consisting of A, T or U, C, and G.
Ambiguous nucleotides (e.g. M, V, X) are not recognized.
Whitespace and numbers are ignored.
The start amino acid appears in red.
The stop codon is translated as "*" (default) unless otherwise specified and appears blue.
Spoiler: Show

Actually, this is basically right too. Just took the mRNA triplet codon of three nucleotide's to any possible tRNA anti-codon in Eukaryotas for the 20 standard amino acids involved in translation. Basically a reverse codon of tRNA which is kinda neat.

amino acid -> tRNA anticodon -> mRNA codon

Then you can convert each DNA sequence through individual genetic codes like ciliate, dasycladacean and hexamita nuclear code, whatever fuck that is. What coding can do for you, man.
To all the the ladies, peace, and humptiness.

Image

ask me about film, novels, fashion, cinematography, and/or music & you'll have my ear for hours

Doldol 🐾: I'm a Hyper Nova
Doldol 🐾: Kharn can be a
Doldol 🐾: Super Massive Black Hole
EgN-S| Needy: lmao
Doldol 🐾: xD
EgN-S| Needy: dude idk why, but i thought you were going to say super massive black cocc
Doldol 🐾: You can be a
Doldol 🐾: LOL
Doldol 🐾: nono thatd then be micro astroid
Doldol 🐾: or so ive heard
EgN-S| Needy: Like he's just one big degenerate penus
Doldol 🐾: ROFL
Doldol 🐾: IK
Doldol 🐾: xd

her favourite colour was yellow

Smiley: yes, I have a job now so I can be the breadwinner of the household and you can just relax to Rex all day :)

Image

life goals
[  ] become legend before mootinie
[  ] get 10,000 post before mutiny
[  ] marry smiley

Tricky: i don't think any of the staff+ are here to slap their e-penis on you


Top
 Profile  
  
Offline 
PostPosted: Wed Mar 07, 2018 4:06 am 
User avatar
Staff
Legend
Steam ID: STEAM_0:1:177980773
Joined: Fri Jul 08, 2016 4:44 am
Posts: 2643
English please >:)
Image

*DEAD* EgN|s BEST ADMIN TITTYSPRINKLES: i thought today was rulebreaking day my bad :-(
*DEAD* EgN| Terminator #Fishy Guy: yup, ma dick to long :)


Top
 Profile  
  
Offline 
PostPosted: Wed Mar 07, 2018 11:51 am 
User avatar
EgN Member
Steam ID: STEAM_0:0:2416971
Joined: Fri Aug 25, 2017 2:40 pm
Posts: 522
Needy wrote:
SpazzO wrote:
Using Standard translation code
The translator takes a DNA or RNA sequence consisting of A, T or U, C, and G.
Ambiguous nucleotides (e.g. M, V, X) are not recognized.
Whitespace and numbers are ignored.
The start amino acid appears in red.
The stop codon is translated as "*" (default) unless otherwise specified and appears blue.
Spoiler: Show

Actually, this is basically right too. Just took the mRNA triplet codon of three nucleotide's to any possible tRNA anti-codon in Eukaryotas for the 20 standard amino acids involved in translation. Basically a reverse codon of tRNA which is kinda neat.

amino acid -> tRNA anticodon -> mRNA codon

Then you can convert each DNA sequence through individual genetic codes like ciliate, dasycladacean and hexamita nuclear code, whatever fuck that is. What coding can do for you, man.

No way... I was kinda right? Super stoked :D
Image


Top
 Profile  
  
Offline 
PostPosted: Wed Mar 07, 2018 11:56 am 
User avatar
EgN Member
Elder
Steam ID: STEAM_0:1:17299991
Joined: Fri Dec 05, 2014 2:53 pm
Posts: 337
Location: Dutchlands
Like i feel pretty dumb right now.
Image


Top
 Profile  
  
Offline 
PostPosted: Wed Mar 07, 2018 12:17 pm 
User avatar
Staff
Legend
Steam ID: STEAM_0:1:43792252
Joined: Wed Nov 11, 2015 4:07 pm
Posts: 2713
7‌‌
-No Pity For A Coward-
http://cdn.funnyisms.com/ecc914b3-1ce2-4aa7-8b36-992cf563121f.jpg
"im srry, i din mean it massta, lil simple is gone be a good boy massta" -Mr. Simplistic
"Your taste in music is A2+ and I like how you moto." -Needy

Image


Top
 Profile  
  
Offline 
PostPosted: Wed Mar 07, 2018 12:28 pm 
User avatar
Community Member
Legend
Steam ID: STEAM_0:0:150625838
Joined: Mon Oct 12, 2015 2:42 am
Posts: 4024
Location: NorCal
Yiggles Moto wrote:
7‌‌

Yes
To all the the ladies, peace, and humptiness.

Image

ask me about film, novels, fashion, cinematography, and/or music & you'll have my ear for hours

Doldol 🐾: I'm a Hyper Nova
Doldol 🐾: Kharn can be a
Doldol 🐾: Super Massive Black Hole
EgN-S| Needy: lmao
Doldol 🐾: xD
EgN-S| Needy: dude idk why, but i thought you were going to say super massive black cocc
Doldol 🐾: You can be a
Doldol 🐾: LOL
Doldol 🐾: nono thatd then be micro astroid
Doldol 🐾: or so ive heard
EgN-S| Needy: Like he's just one big degenerate penus
Doldol 🐾: ROFL
Doldol 🐾: IK
Doldol 🐾: xd

her favourite colour was yellow

Smiley: yes, I have a job now so I can be the breadwinner of the household and you can just relax to Rex all day :)

Image

life goals
[  ] become legend before mootinie
[  ] get 10,000 post before mutiny
[  ] marry smiley

Tricky: i don't think any of the staff+ are here to slap their e-penis on you


Top
 Profile  
  
Display posts from previous:  Sort by  
New Topic Post Reply  [ 21 posts ]  Go to page
 Previous << 
1, 2, 3
 >> Next 


Who is online

Users browsing this forum: No registered users and 6 guests


You cannot post new topics in this forum
You cannot reply to topics in this forum
You cannot edit your posts in this forum
You cannot delete your posts in this forum
You cannot post attachments in this forum
Jump to:  

cron
Powered by phpBB3 ©
Website mods by Doldol, banner by synthic, Mootiny.