Elevated Gaming Network :: View topic - tRNA Anti-codon Sequence

Doldol wrote:

winter wrote:

mRNA sequence:
UAC AGU UCG GAU GUA CCU CUA UCA A

tRNA sequence:
AUG UCA AGC CUA CAU GGA GAU AGU U (i think this is correct)

Well I got this generated by Bio Python (Python Bioinformatics library) which should be correct if the mRNA sequence is aka the complement. And the tRNA is aka thymidine to uracil replacement.
(Both starting from the base sequence.)

1. UACAGUUCGGAUGUACCUCUAUCAAUU
2. AUGUCAAGCCUACAUGGAGAUAGUUAA

Which is the same as winter but I guess with padding at the end to conform to some formatting standard?
Imagine doing this manually without a program lolololol

Now use the tRNA Anti-codon chart to basically determine the corresponding letter in the message :s

First Base
Second Base
Third Base

Doldol wrote:

Also asking for homework/science help on these forums tends to be a mistake. :3

I actually already knew the answer but shhh

(Please go full Phd level as that's how the functions/constants are named xD)

Code:

>>> from Bio.Seq import Seq
>>> from Bio.Alphabet import IUPAC
>>> base_sequence = "ATGTCAAGCCTACATGGAGATAGTTAA"
>>> coding_dna = Seq(base_sequence, IUPAC.unambiguous_dna)
>>> coding_dna
Seq('ATGTCAAGCCTACATGGAGATAGTTAA', IUPACUnambiguousDNA())
>>> coding_dna.translate()
Seq('MSSLHGDS*', HasStopCodon(IUPACProtein(), '*'))

here is the correct : msniubvffbjfnkwpkmlbutrexgqplffbwhbdfmamjnfhv

hope it helps :)

Using Standard translation code
The translator takes a DNA or RNA sequence consisting of A, T or U, C, and G.
Ambiguous nucleotides (e.g. M, V, X) are not recognized.
Whitespace and numbers are ignored.
The start amino acid appears in red.
The stop codon is translated as "*" (default) unless otherwise specified and appears blue.

Spoiler: Show

SpazzO wrote:

Spoiler: Show

Actually, this is basically right too. Just took the mRNA triplet codon of three nucleotide's to any possible tRNA anti-codon in Eukaryotas for the 20 standard amino acids involved in translation. Basically a reverse codon of tRNA which is kinda neat.

amino acid -> tRNA anticodon -> mRNA codon

Then you can convert each DNA sequence through individual genetic codes like ciliate, dasycladacean and hexamita nuclear code, whatever fuck that is. What coding can do for you, man.

Author:	Doldol [ Tue Mar 06, 2018 9:18 pm ]
Post subject:	Re: tRNA Anti-codon Sequence
Needy wrote: Doldol wrote: winter wrote: mRNA sequence: UAC AGU UCG GAU GUA CCU CUA UCA A tRNA sequence: AUG UCA AGC CUA CAU GGA GAU AGU U (i think this is correct) Well I got this generated by Bio Python (Python Bioinformatics library) which should be correct if the mRNA sequence is aka the complement. And the tRNA is aka thymidine to uracil replacement. (Both starting from the base sequence.) 1. UACAGUUCGGAUGUACCUCUAUCAAUU 2. AUGUCAAGCCUACAUGGAGAUAGUUAA Which is the same as winter but I guess with padding at the end to conform to some formatting standard? Imagine doing this manually without a program lolololol Now use the tRNA Anti-codon chart to basically determine the corresponding letter in the message :s First Base Second Base Third Base Doldol wrote: Also asking for homework/science help on these forums tends to be a mistake. :3 I actually already knew the answer but shhh You have to tell me what you want :3 Do you perhaps want the protein sequence? (Using NCBI table id 1) >> MSSLHGDS* (* = stop symbol) Is this helping you out or just a fun quiz? Otherwise nvm as this stuff has some of the worst documentation I've seen in a while. (Don't need that game xD) Spoiler: Show (Please go full Phd level as that's how the functions/constants are named xD) Spoiler: Show Code: >>> from Bio.Seq import Seq >>> from Bio.Alphabet import IUPAC >>> base_sequence = "ATGTCAAGCCTACATGGAGATAGTTAA" >>> coding_dna = Seq(base_sequence, IUPAC.unambiguous_dna) >>> coding_dna Seq('ATGTCAAGCCTACATGGAGATAGTTAA', IUPACUnambiguousDNA()) >>> coding_dna.translate() Seq('MSSLHGDS', HasStopCodon(IUPACProtein(), ''))

Author:	Smiles [ Tue Mar 06, 2018 9:24 pm ]
Post subject:	Re: tRNA Anti-codon Sequence
here is the correct : msniubvffbjfnkwpkmlbutrexgqplffbwhbdfmamjnfhv hope it helps :)

Author:	winter [ Tue Mar 06, 2018 11:58 pm ]
Post subject:	Re: tRNA Anti-codon Sequence
Fuckyou

Author:	Needy [ Wed Mar 07, 2018 12:00 am ]
Post subject:	Re: tRNA Anti-codon Sequence
Smiles wrote: here is the correct : msniubvffbjfnkwpkmlbutrexgqplffbwhbdfmamjnfhv hope it helps :) Thanks Smiley, what would I do w/o you winter wrote: Fuckyou ding ding :^)

Author:	Needy [ Wed Mar 07, 2018 12:29 am ]
Post subject:	Re: tRNA Anti-codon Sequence
SpazzO wrote: Using Standard translation code The translator takes a DNA or RNA sequence consisting of A, T or U, C, and G. Ambiguous nucleotides (e.g. M, V, X) are not recognized. Whitespace and numbers are ignored. The start amino acid appears in red. The stop codon is translated as "" (default) unless otherwise specified and appears blue. Spoiler:* Show Key: Start: M, Stop: * 5'3' Frame1: MSSLHGDS* 5'3' Frame2: CQAYMEIV 5'3' Frame3: VKPTWRL 3'5' Frame1: LTISMAH 3'5' Frame2: LSPCRLD 3'5' Frame3: NYLHVGLT Not sure if this is true... I have been using online translation software for years for school. http://db.systemsbiology.net:8080/prote ... lator.html Actually, this is basically right too. Just took the mRNA triplet codon of three nucleotide's to any possible tRNA anti-codon in Eukaryotas for the 20 standard amino acids involved in translation. Basically a reverse codon of tRNA which is kinda neat. amino acid -> tRNA anticodon -> mRNA codon Then you can convert each DNA sequence through individual genetic codes like ciliate, dasycladacean and hexamita nuclear code, whatever fuck that is. What coding can do for you, man.

Elevated Gaming Network http://elevatedgaming.net/forums/

tRNA Anti-codon Sequence http://elevatedgaming.net/forums/viewtopic.php?f=77&t=29474	Page 2 of 3

Author:	Central [ Wed Mar 07, 2018 4:06 am ]
Post subject:	Re: tRNA Anti-codon Sequence
English please >:)

Author:	SpazzO [ Wed Mar 07, 2018 11:51 am ]
Post subject:	Re: tRNA Anti-codon Sequence
Needy wrote: SpazzO wrote: Using Standard translation code The translator takes a DNA or RNA sequence consisting of A, T or U, C, and G. Ambiguous nucleotides (e.g. M, V, X) are not recognized. Whitespace and numbers are ignored. The start amino acid appears in red. The stop codon is translated as "" (default) unless otherwise specified and appears blue. Spoiler:* Show Key: Start: M, Stop: * 5'3' Frame1: MSSLHGDS* 5'3' Frame2: CQAYMEIV 5'3' Frame3: VKPTWRL 3'5' Frame1: LTISMAH 3'5' Frame2: LSPCRLD 3'5' Frame3: NYLHVGLT Not sure if this is true... I have been using online translation software for years for school. http://db.systemsbiology.net:8080/prote ... lator.html Actually, this is basically right too. Just took the mRNA triplet codon of three nucleotide's to any possible tRNA anti-codon in Eukaryotas for the 20 standard amino acids involved in translation. Basically a reverse codon of tRNA which is kinda neat. amino acid -> tRNA anticodon -> mRNA codon Then you can convert each DNA sequence through individual genetic codes like ciliate, dasycladacean and hexamita nuclear code, whatever fuck that is. What coding can do for you, man. No way... I was kinda right? Super stoked :D

Author:	Dutchie [ Wed Mar 07, 2018 11:56 am ]
Post subject:	Re: tRNA Anti-codon Sequence
Like i feel pretty dumb right now.

Author:	Yiggles Moto [ Wed Mar 07, 2018 12:17 pm ]
Post subject:	Re: tRNA Anti-codon Sequence
7‌‌

Author:	Needy [ Wed Mar 07, 2018 12:28 pm ]
Post subject:	Re: tRNA Anti-codon Sequence
Yiggles Moto wrote: 7‌‌ Yes

Page 2 of 3	All times are UTC - 6 hours
Powered by phpBB © 2000, 2002, 2005, 2007 phpBB Group http://www.phpbb.com/