| Elevated Gaming Network http://elevatedgaming.net/forums/ |
|
| tRNA Anti-codon Sequence http://elevatedgaming.net/forums/viewtopic.php?f=77&t=29474 |
Page 1 of 3 |
| Author: | Needy [ Tue Mar 06, 2018 5:02 pm ] |
| Post subject: | tRNA Anti-codon Sequence |
Decode this sequence from DNA to mRNA, then convert that codon back to an equivalent tRNA anti-codon and i'll maybe give you a prize, i have much games liek ds3 complete edition & sid civ 6 DNA sequence: ATG | TCAAGCCTACATGGAGATAGT | TAA ATG = Start: (M) TAA = Stop: (*)
Spoiler:
Show
|
|
| Author: | SpazzO [ Tue Mar 06, 2018 5:17 pm ] |
| Post subject: | Re: tRNA Anti-codon Sequence |
Using Standard translation code The translator takes a DNA or RNA sequence consisting of A, T or U, C, and G. Ambiguous nucleotides (e.g. M, V, X) are not recognized. Whitespace and numbers are ignored. The start amino acid appears in red. The stop codon is translated as "*" (default) unless otherwise specified and appears blue. Key: Start: M, Stop: * 5'3' Frame1: MSSLHGDS* 5'3' Frame2: CQAYMEIV 5'3' Frame3: VKPTWR*L 3'5' Frame1: LTISM*A*H 3'5' Frame2: *LSPCRLD 3'5' Frame3: NYLHVGLT Not sure if this is true... I have been using online translation software for years for school. http://db.systemsbiology.net:8080/prote ... lator.html |
|
| Author: | winter [ Tue Mar 06, 2018 6:11 pm ] |
| Post subject: | Re: tRNA Anti-codon Sequence |
mRNA sequence: UAC AGU UCG GAU GUA CCU CUA UCA A tRNA sequence: AUG UCA AGC CUA CAU GGA GAU AGU U (i think this is correct) |
|
| Author: | Doldol [ Tue Mar 06, 2018 6:50 pm ] |
| Post subject: | Re: tRNA Anti-codon Sequence |
winter wrote: mRNA sequence: UAC AGU UCG GAU GUA CCU CUA UCA A tRNA sequence: AUG UCA AGC CUA CAU GGA GAU AGU U (i think this is correct) Well I got this generated by Bio Python (Python Bioinformatics library) which should be correct if the mRNA sequence is aka the complement. And the tRNA is aka thymidine to uracil replacement. (Both starting from the base sequence.) 1. UACAGUUCGGAUGUACCUCUAUCAAUU 2. AUGUCAAGCCUACAUGGAGAUAGUUAA Which is the same as winter but I guess with padding at the end to conform to some formatting standard? Imagine doing this manually without a program lolololol Also asking for homework/science help on these forums tends to be a mistake. :3 |
|
| Author: | Uchies [ Tue Mar 06, 2018 6:55 pm ] |
| Post subject: | Re: tRNA Anti-codon Sequence |
lol wut |
|
| Author: | Needy [ Tue Mar 06, 2018 7:14 pm ] |
| Post subject: | Re: tRNA Anti-codon Sequence |
Doldol wrote: winter wrote: mRNA sequence: UAC AGU UCG GAU GUA CCU CUA UCA A tRNA sequence: AUG UCA AGC CUA CAU GGA GAU AGU U (i think this is correct) Well I got this generated by Bio Python (Python Bioinformatics library) which should be correct if the mRNA sequence is aka the complement. And the tRNA is aka thymidine to uracil replacement. (Both starting from the base sequence.) 1. UACAGUUCGGAUGUACCUCUAUCAAUU 2. AUGUCAAGCCUACAUGGAGAUAGUUAA Which is the same as winter but I guess with padding at the end to conform to some formatting standard? Imagine doing this manually without a program lolololol Now use the tRNA Anti-codon chart to basically determine the corresponding letter in the message :s First Base Second Base Third Base Doldol wrote: Also asking for homework/science help on these forums tends to be a mistake. :3 I actually already knew the answer but shhh |
|
| Author: | Needy [ Tue Mar 06, 2018 7:17 pm ] |
| Post subject: | Re: tRNA Anti-codon Sequence |
This one should work |
|
| Author: | Needy [ Tue Mar 06, 2018 7:24 pm ] |
| Post subject: | Re: tRNA Anti-codon Sequence |
Uchies wrote: lol wut git outta here dweeb |
|
| Author: | Tricky [ Tue Mar 06, 2018 8:54 pm ] |
| Post subject: | Re: tRNA Anti-codon Sequence |
what class is this o.O |
|
| Author: | Yiggles Moto [ Tue Mar 06, 2018 9:08 pm ] |
| Post subject: | Re: tRNA Anti-codon Sequence |
Tricky wrote: what class is this o.O Needy wrote:
Spoiler:
Show
|
|
| Page 1 of 3 | All times are UTC - 6 hours |
| Powered by phpBB © 2000, 2002, 2005, 2007 phpBB Group http://www.phpbb.com/ |
|